GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
mtDNA 271 or 16271 in found in the Semang in Malaysia
Virtually all of this reaearch has been done by non-LDS scientists, which is the best way to let the truth come out as it eventually will.
H3 represents a smaller fraction of European genome than H1 but has a somewhat similar distribution with peak among Basques (13.9%), Galicians (8.3%) and Sardinians (8.5%). Its importance decreases towards the northeast of the continent though.[1] Studies have suggested haplogroup H3 is highly protective against AIDS progression.[12]
M271 is a new member of Subgroup H3.
mtDNA M271 originated Mainland Southeast Asia Negritos with the CDe or fa;b0b2b3b4b5tCDe found both in Malaysia Negritos and Amerindians.
With this Formula you with pure Caucasian Neanderthal Rh negative blood with various protection natural protect with Cancers and HIV and pure Aryan features form the Jews.
You have foutain of youth because you will have GHRH-R or insensitive Laron Syrdome which will normal child protection and but maturation will occur at the of 2 or 3 years old and young and old charatheristic will be totally preserved for life. You will age very slowly and live longer and with all the protect of against HIV and Cancers and other diseases. You will be a Super no African no Chimpanzee race of people.
The PCR primer sets for HTLV-I-pX were SN543 (5’–AGGGTTTGGACAGAGTCTTC–3’
he worldwide geographic and ethnic clustering of patients
with diseases related to human T-cell lymphotropic virus type I
(HTLV-I) may be explained by the natural history of HTLV-I infection1,2. The genetic characteristics of indigenous people in the
Andes are similar to those of the Japanese3,4, and HTLV-I is generally detected in both groups5
. To clarify the common origin of
HTLV-I in Asia and the Andes, we analyzed HTLV-I provirus DNA
from Andean mummies about 1,500 years old. Two of 104
mummy bone marrow specimens yielded a band of human ß-
globin gene DNA 110 base pairs in length, and one of these two
produced bands of HTLV-I-pX (open reading frame encoding
p40x
, p27x
)
DRB1*08:02-DQA1*04:01-DQB1*04:02 Japan pop 4 2.50 525
DRB1*08:02 Japan Hokkaido Ainu
0.1000 50
Clonotypic analysis of T cells accumulating at arthritic lesions in HTLV-I env-pX transgenic rats.
Sugaya T, Ishizu A, Ikeda H, Nakamaru Y, Fugo K, Higuchi M, Yamazaki H, Imai K, Yoshiki T.
Department of Pathology/Pathophysiology, Hokkaido University Graduate School of Medicine, Sapporo, Japan.
Abstract
Human T cell leukemia virus type I (HTLV-I) env-pX transgenic rats (env-pX rats) develop chronic destructive arthritis resembling rheumatoid arthritis in humans. Immunological characteristics were compared with those of collagen-induced arthritis (CIA). Rheumatoid factor was present in some env-pX rats regardless of the development of arthritis, but not in nontransgenic rats with CIA. All rats with CIA produced anti-type II collagen (IIC) antibody, but never so in env-pX rats with naturally occurring arthritis. Although expansions of oligoclonal T cells were evident in the affected joints, no particular clone was shown to infiltrate into the arthritic lesions in env-pX rats. In contrast to CIA, in which clonal expansions of IIC-specific T cells are implicated, locally expanded T cell clones against various antigens of the joints may play pathogenetic roles in the arthritis seen in env-pX rats. However, complementarity-determining region 3 of the TCR Vbeta gene of T cells accumulating at the affected joints in env-pX rats contained the GGA amino acid sequence, which was reported to be a conserved motif in HTLV-I env-pX transgenic mice with arthritis. These findings suggest that common antigen(s) might be recognized by T cells accumulating at sites of arthritis in both transgenic rats and mice.
Copyright 2002 Elsevier Science.
Unique regulation in the viral replication
HTLV-1 has an extra sequence pX, in addition to gag, pol and env, required for viral replication. However, pX shows no sequence homology to host cell DNA, and thus is not a typical oncogene. Molecular studies on pX ultimately revealed a unique regulatory system essential for HTLV-1 replication. In brief, pX encodes three proteins, Tax, Rex and p21, in overlapping reading frames. Tax is a transcriptional activator of the viral genome (Kiyokawa et al., 1984; Sodroski et al., 1984; Fujisawa et al., 1985) and Rex is a splicing suppressor of the viral transcripts (Kiyokawa et al., 1985; Seiki et al., 1985). The combination of these two proteins regulates sequential and transitory viral expression (Hidaka et al., 1988; Seiki et al., 1988).
As summarized in Figure 2, an initial HTLV-1 transcript is fully spliced into pX mRNA which encodes a protein termed p40-Tax and p27-Rex. Tax trans-activates the transcription of the viral genome; thus viral expression is potently enhanced. Next, p27-Rex, which is encoded by the same pX mRNA in an alternate reading frame, accumulates and suppresses splicing of the viral transcripts. As a consequence, unspliced gag-pol-env and env mRNAs are expressed, and the viral structural proteins are produced. The suppression of the viral RNA splicing reduces the level of fully spliced pX mRNA that codes for the trans-activator Tax, and thus results in downregulation of viral gene expression. Accordingly, the viral gene expression is efficient at the initial stage of infection/gene expression and then is moderated quickly before host immunologic surveillance could be effectively triggered against infected cells. Such feedback regulation through the viral products was uniquely described first for HTLV-1.
one HTLV-1 non-carrier were reported with an investigation of HTLV-1 pX
olymerase chain reaction (PCR) for HTLV-1 pX Tax region
DNA material for PCR was extracted from paraffin-embedded tissue [10] of the cases 1 , 2, 5 to 7 and
from paraffin sections on slide glasses of the cases 3 and 4.
As a pair of primers of PCR for HTLV-1 provirus, SK43 and SK44 primers for pX Taxregion [8] were
employed. Fifty-two cycles of PCR were performed, using GeneAmpTM DNA Amplification Reagent
Kit (Takara Biomedicals). The denatu
ring step was carried out at 94
°C
for 2 min, the annealing of the
primers with DNA was done at 54
°C
for 2 min, and the
extension of DNA was done at 68
°C
for 2 min.
An existence of amplified DNA was eval
uated in 3% agar-gel electrophoresis.
Summary: DNA sequences that form the coding region for at least three proteins which regulate the expression of HUMAN T-LYMPHOTROPIC VIRUS 1 and HUMAN T-LYMPHOTROPIC VIRUS 2. The proteins are p21(x), p27(rex), and ). The tax (trans-activator x) and rex (regulator x) genes are part of pX but are in overlapping reading frames. X was the original designation for the sequences or region (at that time of unknown function) in the long open reading frame (lor) which is now called pX.
The genetic characteristics of indigenous people in the Andes are similar to those of the Japanese, and HTLV-1 is generally detected in both groups. To clarify the common origin of HTLV-1 in Asia and the Andes, we analyzed HTLV-1 provirus DNA from Andean mummies about 1500 years old. Two of 104 mummy bone marrow specimens yielded a band of human β-globin gene DNA 110 base pairs in length, and one of these two produced bands of HTLV-1-pX (open reading frame encoding p40x, p27x)
When the Semang or Aeta Negritos with K-M9 with mtDNA 16519C with sp40 gene or 16519C sp40-HTLV-1px or Insentive Laron Syrdome or GHRH-R or Growth Hormone Release Receptor Gene or GHRH-R in the Semang and possibly the Aeta Negritos who the Ainu descend from in Japan. The Semang witth mtDNA 271 with has protection against HIV and HTLV-I because HTLV-Ipx virus with p40(tax)HTLV-1px with
Sp38-40.B genes is the same as p40(tax)HTLV-1px
both haveGAGTCTTC or Eurasian 16519C sp40-HTLV-1px
K-M9 in Negritos with HTLV-I virus get irridated with Clovis Comet and create a Super Aryan race people. with The haplotype DRB1*0802-DQA1*0401-DQB1*0402 which has the p40(tax)HTLV-1px this came Amerindian people like Mayans, Aztec and Inca and Lakota or Blackfeet Sioux India who directly related the Ainu in Japanese and the Tocharian in Xinjiang province with both Q1a3b or Q1b and K2-M70
DRB1*0802-DQA1*0401-DQB1*0402 in Salishan Sioux and Mayan and Mezetecan or Coastal Native Americans Indians.
The PCR primer sets for HTLV-I-pX were SN543 (5’–AGGGTTTGGACA-GAGTCTTC–3’
Sp38-40.B genes is the same as p40(tax)HTLV-1px
both haveGAGTCTTC or Eurasian 16519C sp40-HTLV-1px
GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
mtDNA 271 or 16271 in found in the Semang in Malaysia
DRB1 0802
:
: DR52
:
: DRB3*0101 or HPA1a or B Rh negative carrier
:
: HPA 1a–negative women were also HLA DRB3
: genotyped
: HLA DRB3*0101 typing
:
:
: look at these things. DRB3*0101, DR52 and
: DRB1*0802 or HLA DRB1 0802 DQA1 0401 DQB1
: 0402 which is found in The Mitchell Gypsy
: family the Draculest family.
:
:
: DRB3*0101, DR52 and DRB1*0802 or HLA DRB1
: 0802 DQA1 0401 DQB1 0402 is found
: Zoroastrian in Pars and Yazd or the Persian
: Royal family both from Darius and Yazdegerd
: III with from Jewish Exilarch in Babylon. It
: come Solomon and Sheba Royal House of David
: and DRB3*0101, DR52 and DRB1*0802 or HLA
: DRB1 0802 DQA1 0401 DQB1 0402 in Sumeria
: with Lilith Jewish ancestor which from Ainu
: Japanese with DRB3*0101, DR52 and DRB1*0802
: or HLA DRB1 0802 DQA1 0401 DQB1 0402
: Hashimoto's thyroiditis or Graves Disease
: like Pavavoratti Daughter, Message!
: DRB3*0101, DR52 and DRB1*0802 or HLA DRB1
: 0802 DQA1 0401 DQB1 0402 is the Lakota Sioux
: Indian tribe and the got DRB3*0101, DR52 and
: DRB1*0802 or HLA DRB1 0802 DQA1 0401 DQB1
: 0402 from Mayan indians DRB1*0802 alleles
: are found in 50% of Mayans
Message Thread
« Back to index