Bosch et al. [14] studied Y chromosome variation in the Balkans, including a sample of 41 Greeks. Greeks belonged to the major Caucasoid haplogroups. The identity of the K*(xP) chromosomes is not clear, but they could belong to the minor Caucasoid haplogroups K2 and L which have been previously observed in Greeks, or to other K-related lineages.
Your Official Report
Your mtDNA results have been successfully added to the Ancestry.com DNA database. You may now explore how your results match with others, join a DNA Group, or add your DNA results to your family tree.
LOCATION 73G 150T 195C 263G 315.1C 16223T 16320T 16519C
REFERENCE A C T A : C C T
Major Frank Warren G T C G C T T C has 7/8 of the Pure Caucasian Chromosome only 315.1C is non Caucasians.
73G 150T 195C 263G 16223T 16320T 16519C are all on the pure Caucasian Chromosome.
The M20 marker (Underhill et al. 1997) was genotyped, by use of the primers CACACAACAAGGCACCATC and GATTGGGTGTCTTCAGTGCT followed by SspI digestion; the A→G mutation destroys the site at position 118 in the 413-bp product. M11 (Underhill et al. 1997) was typed, using the primers TTCATCACAAGGAGCATAAACAA and CCCTCCCTCTCTCCTTGTATTCTACC
Now,(GTCGCTTC) with L-M11 is related to Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
or GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 and M232
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
f T2b is 12-10kya, and T1/ T2 coalesced about 19kya, T2b might very roughly originate about 10,000 to 15,000 years ago.
THINGS I NOTED ABOUT MUTATIONS DIFFERENT IN BIGFOOT AND HUMANS:
One thing I noted was that all the 52 number diverse T2b haplogroup listed humans in the T2 project had a mutation 146T, but none of the Bigfoot had that mutation. It seems in fact that all T haplogroup have 146T. I am guessing that the earliest common ancestor of all Bigfoots had a back mutation on that marker to the CRS value.
Another thing I noticed was that all Bigfoots which appear to have been tested on the lower number markers, have mutation 73G. Yet not one of the
52 human mtDNA T2b persons had the mutation 73G. Why not? Was 73G a very early mutation in the Bigfoot line?
All the fully tested 4 Bigfoots had the 263G mutation, but not one single one of the 52 humans had 263G. Why not? This is -K-M9 or K-M70 or U8 DNA from K-M9 Neandertal Negritos like the Semang and Aeta who came for the Pacific Rim and settle in the Coastal Area of the the Americas the in the North they called Clovis people of Salish people or Coastal Indian who form Canada, to Baja in Mexico to Perua and Chile carrying both B Rh ryr negative type and after radition exposer to the Clovis Comet with DRB1*0802-DQA1*0401-DQB1*0402 in Salishan Sioux and Mayan and Mezetecan or Coastal Native Americans Indians.
the Luekmia virus and HIV. A bullet that kills a bullet.
Sp38-40.B genes is the same as p40(tax)HTLV-1px
both haveGAGTCTTC or Eurasian 16519C sp40-HTLV-1px
K-M9 in Negritos with HTLV-I virus get irridated with Clovis Comet and created a Super Aryan race people. with The haplotype DRB1*0802-DQA1*0401-DQB1*0402 which has the p40(tax)HTLV-1px this came Amerindian people like Mayans, Aztec and Inca and Lakota or Blackfeet Sioux India who directly related the Ainu in Japanese and the Tocharian in Xinjiang province with both Q1a3b or Q1b and K2-M70
DRB1*0802-DQA1*0401-DQB1*0402 in Salishan Sioux and Mayan and Mezetecan or Coastal Native Americans Indians.
the Luekmia virus and HIV. A bullet that kills a bullet.
Sp38-40.B genes is the same as p40(tax)HTLV-1px
both haveGAGTCTTC or Eurasian 16519C sp40-HTLV-1px
K-M9 in Negritos with HTLV-I virus get irridated with Clovis Comet and created a Super Aryan race people. with The haplotype DRB1*0802-DQA1*0401-DQB1*0402 which has the p40(tax)HTLV-1px this came Amerindian people like Mayans, Aztec and Inca and Lakota or Blackfeet Sioux India who directly related the Ainu in Japanese and the Tocharian in Xinjiang province with both Q1a3b or Q1b and K2-M70
DRB1*0802-DQA1*0401-DQB1*0402 in Salishan Sioux and Mayan and Mezetecan or Coastal Native Americans Indians.
Quetzalcoatl
Qpetzalcoatl, which means “feathered serpent”, is the god of twins and learning.
Twin brother of the Aztec god Quetzalcoatl.
Axolotl was the twin of Quetzalcoatl, the pair being sons of the virgin Coatlicue, and was the dark personification of Venus, the evening star.
In Aztec and Toltec mythology, Xolotl ("The Animal", Lord of the Evening Star, Lord of the Underworld) was the god of lightning and a psychopomp, which is to say that he was the one who aided the dead on their journey to Mictlan, the afterlife.
Parsi (Qamar et al.)
n=90
P-92R7(xR1a1a) - 26.7% (presumably other R clades such as R2)
Y*(xA,C,DE,H2,J,K) - 3.3% (potentially be G, H1, I, most likely G considering it's distribution across the Indo-Iranian world)
R1a1a-M17 - 7.8%
J-12f2 - 38.9% (probably J2 > J1 to match the trend across Iranic-speaking ethnic groups)
E-SRY8299(xE1b1a) - 5.6% (obviously E1b1b)
L-M20 - 17.8%
Modern Human: G, T, T, C, C, A, A
Modern Australian Aborigine: A, C, C, T,T, C, G
30,000 yr Neanderthal: A, C, C, T, A, G, G
: value are in the extreme north.
: A Caucasoid haplotype, f;b0b1b3b4b5b has an
: average frequency of 2.7 and Peak in
: Greenland with Aluets Eskimo and the
: Northern part of South American in Mayans
: and Quecha in Peru .
: Cde is somewhat higher in southeastern India
: and is elsewhere uniformly low or absent
: except around the Caspians Sea. cdE is also
: low everywhere, being slightly in higher in
: western part of Central Asia and around the
: Sea of Japan.
: 12,000 years ago the the Rh Cde Dravidians
: in Southeastern India migrated in Aral Sea
: to cdE with Aztec and Mayan and and high in
: extreme South America in Quecha in Peru
: about 3%
: So when the Rh Cde/cde Dravidians
: f;b0b1b3b4b5b in Central Asia mixed with the
: Altaic Native Americans like from Siberia
: that made the Kurgans Rh CdE Aryan race with
: the Aleuts Kurgans Rh Ryr (CdE/cde
: f;b0b1b3b4b5b and Andean Indians like the
: Quecha with Ryr (CdE/cde )f;b0b1b3b4b5b
:
: The(O- Blood type)in Aluets or Eskimo and
: Incas and some Mayans were black Aryan
: Caucasian like Elmo-Dravidians the ancestors
: of the Persians. They were the Caucasian Rh
: negative the same the Black Dravidian,(B-
: blood type) Persians,(B- blood type)
: Basque(O- Blood type) and Saami. (A- blood
: type)
: The(O- Blood type)in Aluets or Eskimo and
: Incas are related to the Basque too.
:
:
: On my mother father side we have The very
: rare Rh (B- blood)genotype Ryr (CdE/cde) in
: a case of erythroblastosis foetalis from the
: Rudari Gypsy related to Parsis in Karachi
: with DRB3*0101, DR52 originally from
: Amerindians.
:
:
:
: On my mother mother side have DRB3*0202 from
: O-Blood Basque from our Creole ancestor form
: Louisiana
:
: Ryr or ryr CdE originated from Cde
: Dravidians R1a mixed with Ainu Japanese with
: cdE and Q1a3 in Northeast Asia which created
: the Ural-Altaic (ighg 1G3 fbo1b3-b4-b5
: rh-cde all this was created in the
: Tocharians Race from Xinjiang Province in
: Northeastern China. The Tocharian are Both B
: an B Rh negative blood with DBR3*0101 DR52
: and DBR1*0802 in Ainu and Amerinds
:
: Tocharian Ryr (CdE/cde )f;b0b1b3b4b5b) Pure
: Caucasians
:
: The very rare Rh genotype Ryr (CdE/cde) in a
: case of erythroblastosis foetalis.
: rare r y (CdE) gene (=0.7%) in the Parsis is
: one of the most unique findings described
: so far in any population of the world. In
: Parsis it is poplymorphic whereas it is just
: sporadic in occurrence that too in a few
: populations only, the world over.
:
: Ural-Altaic (ighg 1G3 fbo1b3-b4-b5 rh-cde
:
The PCR primer sets for HTLV-I-pX were SN543 (5’–AGGGTTTGGACAGAGTCTTC–3’ Negritos Amerindian Leukemia virus the kills the Luekmia virus and HIV. A bullet that kills a bullet.
Sp38-40.B genes is the same as p40(tax)HTLV-1px
both haveGAGTCTTC or Eurasian 16519C sp40-HTLV-1px
haplogroup K2-M70, which I believe to be
: closely related to haplogroup L-M11
: Dienekes Pontikos wrote:
: > > Haplogroup L-M11 is frequent in
: parts of the
: > Caucasus, and it was
: > > found at a frequency of around 5%
: in Calabria, as
: > well as in Greece,
: > > Turkey, Georgia, Hungary, etc.
: >
: > Actually, L-M11 is the prominent
: Haplogroup of
: > Indo-Iranians. In days of
: > Darius I, the Medo-Persians (in other
: words
: > Indo-Iranians) established
: > intensive administratve presence in
: many parts of
: > Greek World.
: >
: > Dienekes Pontikos wrote:
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
K-M9 in Negritos with HTLV-I virus get irridated with Clovis Comet and created a Super Aryan race people. with The haplotype DRB1*0802-DQA1*0401-DQB1*0402 which has the p40(tax)HTLV-1px this came Amerindian people like Mayans, Aztec and Inca and Lakota or Blackfeet Sioux India who directly related the Ainu in Japanese and the Tocharian in Xinjiang province with both Q1a3b or Q1b and K2-M70
DRB1*0802-DQA1*0401-DQB1*0402 in Salishan Sioux and Mayan and Mezetecan or Coastal Native Americans Indians.
Japanese Ural-Altaic (ighg 1G3 fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- or pure Caucasian race people.
fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- and B- Rh negative with also carry Laron Syndrome of B Rh negative with H3 haplogroup or subtype 271
GHRH-R or insensitive Laron Syndrome protect against various cancers.
DRB3*0101 and DR52a from Gorrilla or Homo Erectus Neanderthal
B blood some protect against HIV
B Rh negative have great protect agianst HIV
The Gurna were Jews form Goshen or Thebes and they came to Egypt in the 18th Dynasty introduce eygpt to the Underworld and Osiris and Sekmet and Bestan the Cat People or Vampire at the city and Temples of Thebes were they came from 2800 D.C. in the 18th Dynasty of Amenhotep I when made contact with Babylonians or Sumerian Jewish people or the Gurna. The Gurna people have 6519, 73 and 195) or 73, 150, 195 which Jewish-Egyptian Markers the Gurna were the Rh negative Gurna jewish Pharaoh but they are the original ancestor of the Gypsy people who have
Moses and Ramesis II K-M9-xL-M20 mtDNA and J1b Y Chromsome both are Cohanim.
1/92 = 1.1% K-M9(xL-M20, M1-M4, N1-LLY22g, O-M175, P-P27, T-M70) in Pharaoh King Tut could even be a T-M70 (formerly called K2; found at 8 or 10% in Egypt today). mtDNA I wouldn't know where to start. I hope they release something soon. If there was indeed any haplogroup testing done at all.
The haplogroup K2 was found in 10.4% of Somali males. Haplogroup K2 was suggested to have arisen in Eurasia.4, 9 K2 has a patchy distribution in Cameroon (18.0%), Egypt (8.2%), Ethiopia (4.8%), Tanzania (3.8%) and Morocco (3.6%), probably due to back migration.3, 7, 8, 9 Luis et al9 estimated an expansion time of 13.7–17.5 ky for the K2 lineages in Egypt. The BATWING expansion time estimated for K2 in our Somali population (3.3 ky) is consistent with an African southward dissemination of the K2 haplogroup
The paternal haplogroup T-M70 varies between 3% and 24% of male lineages in Germany.
The House of Hohenstaufen, also known as the Swabian dynasty or the Staufer, was a dynasty of German monarchs in the High Middle Ages, reigning from 1138 to 1254. Three members of the dynasty were crowned Holy Roman Emperors. In 1194, the Hohenstaufens were granted the Kingdom of Sicily. The name Hohenstaufen (High-Staufen) for the Staufer was used in Stankovich Circus in 1820 which is 180 years ago after they came to Rio de Janiero after Brazilian independence from Portugal and the massive German and Austro-Hungarian immigration in 1820ths.subsequent periods parallel with the name of the chiefly Prussian Hohenzollern dynasty.
Stankovich Circus in 1820 which is 180 years ago after they came to Rio de Janiero after Brazilian independence from Portugal and the massive German and Austro-Hungarian immigration in 1820ths.
Arrival of Germans in Southern Brazil.
Immigration properly started with the opening of the Brazilian ports, in 1808. The government began to stimulate the arrival of Europeans to occupy plots of land and become small farmers. In 1812, settlers from the Azores were brought to Espírito Santo and in 1819, Swiss to Nova Friburgo, Rio de Janeiro. After independence from Portugal, the Brazilian Empire focused on the occupation of the provinces of Southern Brazil. It was mainly because Southern Brazil had a small population, vulnerable to attacks by Argentina and the Kaingang Indians.[11]
From 1824, immigrants from Central Europe started to populate what is nowadays the region of São Leopoldo, in the province of Rio Grande do Sul. According to Leo Waibel, these German immigrants were mainly "oppressed peasants and former soldiers of the army of Napoleon." In 1830 a bill was passed forbidding the Imperial government from spending money with the settlement of immigrants, which stalled immigration until 1834, when the provincial governments were charged with promoting immigration.[12]
In 1859, Prussia prohibited emigration to Brazil. This was mainly because of complaints that Germans were being exploited in the coffee plantations of São Paulo. Still, between 1820 and 1876, 350,117 immigrants entered Brazil. Of these, 45.73% were Portuguese, 35.74% of "other nationalities," 12.97% Germans, while Italians and Spanish together did not reach 6%. The total number of immigrants per year averaged 6,000.[13] Many immigrants, particularly the Germans, were brought to settle in rural communities as small landowners. They received land, seed, livestock and other items to develop.
A second “wave” went to Santa Catarina in the 1850s, but also to Rio de Janeiro, in smaller number, mainly to a city called Petropolis, where the Emperor Dom Pedro II’s summer house (nowadays the Imperial Museum) was located. Other German immigration waves occurred in the 1890s, as well as after the First and Second World War. The latter emigres were not necessarily only refugees, but also people who were tired of the war. They had different destinations: to the states of Sao Paulo, to Paraná, and to the other Brazilian states.
Most of Brazil's Gypsies belong to the following groups: the Kalderash, who consider themselves aristocrats and the true guardians of the Gypsy identity; the Macwaia (pronounced Matchuaia) who are inclined to abandon nomadism and live a "crypto-Gypsy" life and are thus tending to lose their identity; the Rudari, most of whom are from Romania, live and prosper in Sao Paulo and Rio de Janeiro; the Horahane who originally came from Greece and Turkey and are mostly hawkers; and the Lovara whose culture is in marked decline and who pass themselves off as Italian immigrants.
In the mid-to-late-19th century, many German-Russians migrated to the state of Paraná, more specifically, to near Ponta Grossa city, in Campos Gerais region (a savannah). After a failure in wheat cultivation, many re-emigrated to Argentina or the USA.
German immigration to Brazil started in 1824 — just after Brazil won independence from Portugal — as a result of Brazilian Emperor Dom Pedro I’s (1798-1834) need to populate uninhabited regions of the huge country. Such regions were being disputed with neighbouring countries such as Argentina and Paraguay. Uruguay was just becoming independent. Those countries were by then former Spanish colonies, as all of South America was becoming independent, and all of them were interested in receiving European knowledge, expertise and labor.
Most of the Poles immigrated to Brazil with German, Russian or Austro-Hungarian/Austrian passports, the Ukrainians with Austrian passports and the Hungarians with Romanian passports.
K-M70 and L-M20 OR L-M11 in Darius Persians were Tocharian with GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 and M232 in Yemen Jews.
The Caucasian Race were created in Egypt or Levant 12,000 years when Native Americans carrying Tb2 or Bigfoot DNA or K-M70 came to Egypt 12,000 years ago when the Clovis Comet Hit North American irradition the Amerindian or Salish Coast Indian population some who were Celtic Caucasian Amerindian people who were living the Coastal America and created B ryr Rh negative with The Celtic-Amerindian migrated to Northern China 12,000 years ago and the Himalayas where both B Rh ryr negative and B blood type both originated with Tocharians people or Ural-Alatic people IGHGf;b0b2b3b4b5bstcde pure caucsians people migrated to the Indus Valley where mixed with black Elamites who became the ancestors of the L-M11 Persian and Medes in Sumeria they were the Gutian-Tocharian or Kurdish people form who the Yazidi from originaste form Ur and Lagash and Basra. Yazidi are a Kur or Underworld people. They Gutian Tocharian like Ebony black Elamite from Susa Ahura Mazda or Varuna. But the originate Tocharian people were lightskinned and Celtic-Amerindians so the Matriarch was Ural-Alatic or Pure Jewish that come form Salish Celtic Caucasian-Ameridian tribes. They migrated to Egypt in 18th dynasty where Bastist or Vampire originated like Osiris who was a Gurna from Goshen in the City of Thebes.
It is form the Jewish Gurna people with J1b haplgroup and B Rh ryr negative of the Jewish Tocharian Pharaoh like Moses and Ramesis II the Great that the Gypsy or Romani people originated they were called the Falasha and the purest of the pure Falasha were B ryr R negative at 1%. They had Buda or the Evil Eye, The had Fortune Tellering they were know as Ravnos or Vampire people. Solomon and Sheba son Menelik or Raubaum Falasha or B Rh negative Ethiopian lost his Kingdom or Judah and Isreal to Joaraboam the King of Israel. Menelik the left part his family behind in Judah, and they fled to Ethiopia and started migrated down the Nile form Elephantine to Askum and Gondar. Menelik family in Judah became Babylonian Captives and Exiles Princes and Princess called Exilarch or the Kings and Queen of the Jews. The 21th Exilarch Mar Abba daughter Shushandukt was such a Exilach Princess who married Yazdegerd I and his Great Grand Son Yazdegerd III was the last Zoroastrian King of Persia with J1b from the Exilach and B ryr negative form Nazbanu a Noble Persian Persian form Pars Persia who fled to Karachi and her other Brother Piroz who fled with Tajik to Northern China. The Lovari descend from Nazbanu in Karachi who form the Banu Sassan or Persian Army. They Lovari were Noble Parsi Soldier were part originally part of the Persian Calavary. They were well train horse Whisper that go far back in Persia History to Zoroaster and Jamasb the son of the Bibicial Daniel both were Horse Healer and Whispers in 550B.C. These Lovari or Persian fled form Persia to Karachi with other Parsi then during the invasion the Ismaili they fled Vaspurkhan were they still was Persian Kingdom form the House of Varaz. Then the Muslim invaded Vaspurkhan so Senekhnem of Vaspurkhan who wife was a Gypsy Princess who B Rh negative was kidnapped by Alam Mendez who took to Lustiana in Portugal who found the Brazilian Empire. The other Lom or Lovari in America from Kirov in Baku were there once was Fire Zoroastrian Temple and from Armenia they came to Bulagrian were are not only Iranian people but they have alot of Ethiopian Jewish HLA-Typing there Noble Persian Bulgarian fled to the Principally of Bulgary or the Greek Lovari part of Bulgaria were in 1431 Vlad Dracul brought 12,000 Bulgarian Gypsies to Wallachia and inslaved them. He married one of them and here name was Caltuna and She was B rh negative and Noble Gypsy and Noble Parsi descent and she was descend form The Sultan Celeb or Celli family in Bulgaria and Slovenia who were B Rh negative Gypsy Concubine left of form Greek Population of Constinople Greeks. They were L-M11 and B rh negative both in Vlad Dracula female bloodline and it form Vlad Dracula female blood that Emil Kirova or Mitchell family descend. Emil parent dead by they time here was 16 years old when became King of the Gypsies. Thomas Kirova or Mitchell was his father and was a Lovari born in Hungary and Mother was Greek Lovari Solamia Yovanovich born as a Lovari Greek Gypsy. They Lovari came form Wallachia more than 700 years in the 13th Century to Tosha and it with the Tosha Kalderash and Lovari family in Mexico who the Mitchell or Lovari family in New Orlean was associated with. Gypsies are form Egypt not India. They were part the Persian Noble Establishment form more than 2500 years were the Lovari originated form Zoroaster and Jamsab, They were have long believe in Buda the Evil Eye and Vampirism or Cat People both which Gypsy people are. They are also Gutian-Tocharian or pure Caucasian people the elite of them are came form Persia as Parsi Persian not Indians.
The Lovari true Aranoi Gypsies especially with the worship of Saint Bibi or Durga who is Anahita in Persia or Ianna in Sumeria who the Virgin Mary to Christian and Whope to Native American she more than 12,000 years old and she also on top of B ryr negative she have Big foot Amerindian DNA created 12,000 years when the Clovis Comet form Orion Belt hit the Earth and Cat People or Witches populated the Earth and they now ready to fully after 12,000 to full take control of the Earth. With both Ianna who the wife of Tammuz and half sister and Lilith and Geshtianna who other sister and other wife all join in control of this new Magical world Arinoi Cat People.
f T2b is 12-10kya, and T1/ T2 coalesced about 19kya, T2b might very roughly originate about 10,000 to 15,000 years ago.
THINGS I NOTED ABOUT MUTATIONS DIFFERENT IN BIGFOOT AND HUMANS:
One thing I noted was that all the 52 number diverse T2b haplogroup listed humans in the T2 project had a mutation 146T, but none of the Bigfoot had that mutation. It seems in fact that all T haplogroup have 146T. I am guessing that the earliest common ancestor of all Bigfoots had a back mutation on that marker to the CRS value.
Another thing I noticed was that all Bigfoots which appear to have been tested on the lower number markers, have mutation 73G. Yet not one of the
52 human mtDNA T2b persons had the mutation 73G. Why not? Was 73G a very early mutation in the Bigfoot line?
All the fully tested 4 Bigfoots had the 263G mutation, but not one single one of the 52 humans had 263G. Why not? This is -K-M9 or K-M70 or U8 DNA from K-M9 Neandertal
LOCATION 73G 150T 195C 263G 315.1C 16223T 16320T 16519C
REFERENCE A C T A : C C T
Major Frank Warren G T C G C T T C has 7/8 of the Pure Caucasian Chromosome only 315.1C is non Caucasians.
73G 150T 195C 263G 16223T 16320T 16519C are all on the pure Caucasian Chromosome.
Modern Human: G, T, T, C, C, A, A
Modern Australian Aborigine: A, C, C, T,T, C, G
30,000 yr Neanderthal: A, C, C, T, A, G, G
Bosch et al. [14] studied Y chromosome variation in the Balkans, including a sample of 41 Greeks. Greeks belonged to the major Caucasoid haplogroups. The identity of the K*(xP) chromosomes is not clear, but they could belong to the minor Caucasoid haplogroups K2 and L which have been previously observed in Greeks, or to other K-related lineages.
Haplogroup L-M11 is frequent in parts of the
> Caucasus, and it was
> > found at a frequency of around 5% in Calabria, as
> well as in Greece,
> > Turkey, Georgia, Hungary, etc.
>
> Actually, L-M11 is the prominent Haplogroup of
> Indo-Iranians. In days of
> Darius I, the Medo-Persians (in other words
> Indo-Iranians) established
> intensive administratve presence in many parts of
> Greek World.
>
> Dienekes Pontikos wrote:
> > Presumably L could have arrived to Southern Italy
> by either Neolithic
> > farmers, or the Greeks.
>
> There is no need to stipulate the "Neolitic" sources
> for the expansions
> which are well documented in the recorded history of
> relatively recent
> times. In the case of L-M11, it is the Persian
> Conquest of Eastern
> Mediterranean.
>
> Likewise, K2-M70 is distributed across the areas
> related to Greek
> civilization.
> Actually, L-M11 is the prominent Haplogroup of Indo-Iranians. In days of
> Darius I, the Medo-Persians (in other words Indo-Iranians) established
> intensive administratve presence in many parts of Greek World.
Message Thread
« Back to index