on December 9, 2012, 3:25 pm
Q=1.9%- Typical of Northern Altaic populations.
A skull analysis of Xiongnu burials made by G.F. Debets found a distinct Paleo-Siberian type of Asian facial
appearance with "not a flat, but with not strongly protruding nose," somewhat similar to some North American
Indians (haplogroup Q). This type is represented on the embroidery from Noin-Ula.
Portraits found in the Noin-Ula excavations demonstrate other cultural evidences and influences, showing that
Chinese and Xiongnu art have influenced each other mutually. Some of these embroidered portraits in the Noin-Ula
kurgans also depict the Xiongnu with long braided hair with wide ribbons, which are seen to be identical with the
Turkic Ashina clan hair-style, while a later famous portrait of Kul Tikin (Tegin), the Kaghan of Celestial Turks
from the Ashina Clan, shows typical haplogroup Q facial features (The “Gold (Kagan’s)" clan of the ancient Türkic
dynastic tribe Ashina (< Hot.-Sak. ashsheina “blue”,"dark blue”) was called Shar-Duly (< Middle Persian zarr duli
“Golden bird Duli”,"Golden/Red Raven”). In that clan was born prince Kül-Tegin..)
Your Jews are more like Mongols than Magyars hence the Q haplogroups in Jews.
Hence Jews having Turan surnames like Khan (Genghiz Khan) like that Jewish sexual degenerate of the IMF Dominique Strauss Khan.
Jews have Turan surnames like Kagan (A Avar title like a king or Tsar)
Major Frank Warren mtDNA gtgtgccttc from Yemenite Jews from Q haplogroup and L-M11 haplogroup from Darius the Great and Persian Zoroastrians from Parsis
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C
Study of an American Negro Family with the Rare Rh Genotype ryr (CdE/cde)
The very rare Rh genotype Ryr (CdE/cde) in a case of erythroblastosis foetalis.
rare r y (CdE) gene (=0.7%) in the Parsis is one of the most unique findings described
so far in any population of the world. In Parsis it is poplymorphic whereas it is just
sporadic in occurrence that too in a few populations only, the world over.
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations. The Yemenite became the Exilarch Jews which the descend from 21th Exilarch Mar Abba who daughter Shushandukt Married Yazdegerd I who Yazdegerd III who J1b in B Rh negative descend from and his daughter Nazbanu from Pars mtDNA is L-M11 haplgroup with B Rh negative from gtgtgccttc from Yemenite Jews from Q haplogroup and are Rh Genotype ryr (CdE/cde) which came from the Q haplgroup Atalic Kagan or Kurgan Native American people in Northeast Asia related the Aluet who Genotype ryr (CdE/cde) related the Japanese Ainu and Inca Indians also related to Japanese Ainu with very high level or Genotype ryr (CdE/cde) and A- Rh negative Ainu Japan with so both the Aluet or Eskimos and Inca Indian related to the Ainu Altaic Kurgan people of Northeast Asia where Rh negative is at it Highest peak in Asia according to Genetics Cavalli Sforza of Standford University. So I am pure Rh negative and my ancestor are Rh negative Q haplogroup Native America Altaic Kurgan Aryan people. I am pure Aryan. I am Kurgan Highland, Kurgan is my prize. The Elamo-Dravidian were true Proto-Persian black and white Aryan Kurgan people.
at position 296 GroupVIII. Discovered while typing M232
Q1a3b M323 (Yemenite Jews only)
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
Message Thread
« Back to index