on December 13, 2012, 5:13 am
B blood type in Gorilla. DRB3*0101 in Gorilla and a very few Gorilla are infact Rh D- negative or pure Rh negative. Northeast Asia is where Rh negative reaches it peek in Xiongnu Q haplogroup people. Which came found all the with Blackfeet Sioux Dakota with A Ryr CdE/cde and the Andes Quecha O Ryr Cde/cde but that not pure B blood type Rh negative Gorilla of little foot and Bigfoot blood type that would be Yeti in Himalayas with B Blood type, Ryr CdE/cde, DR52, DRB3*0101 and Virgin Mary is a direct descendant of Yeti form the Himalayas with B blood Ryr CdE/cde, DR52, DRB3*0101. Yet is a pure Ryr CdE/cde B Blood type Homo Erectus the descend from Gorilla Homonid species from Gorilla like Homo Hobbit 1.8 million years ago in the Flores Islandes in Indonesia in Southeast Asia. This is ancestor of Neanderthal but unlike A blood type and O Blood type. B type Blood type Neanderthal are pure Caucasians, why because they B blood type Gorilla, B Blood Homo Erectus, B Rh negative blood type Gorilla or Cde/cde which was created in the Himalayas when both the Xiongnu Aryan tribe and the Yet B and B – Blood type came from. f;b0b2b3b4b5bstcde pure Caucasian haplotype which on found not in the Basque O- Blood with DRB3*0202(Chimpanzee) or the A- Saami with DRB3*0202 in the Cro-magnon(Chimpanzee blood) but the pure f;b0b2b3b4b5bstcde Caucasian Haplotype is found originally only B Rh negative from Tocharians and Xiongu Aryans tribe Proto-Indo-European from 12,000 years. So let put end to Pure Caucasian B S, once and for all!
If you don’t have B Blood type, Ryr CdE/cde, DR52, DRB3*0101 like Parsis from Pars do then you are not a pure Caucasian! Your something else white but not pure Caucasian. I happen to be B blood Ryr CdE/cde, DR52, DRB3*0101. Yet is a pure Ryr CdE/cde B Blood type Homo Erectus the descend from Gorilla Homonid species from Gorilla like Homo Hobbit 1.8 million years ago in the Flores Islandes in Indonesia in Southeast Asia. Blonde Hair and Blue just don’t cut it nor belong in to the Klan, Neo-Nazi, Hell Angel who whatever white hate organization. Let the Nazi check my research and see if I am not 100% Right! gtgccttc with 296 GroupVIII originated in Neanderthal in Paupa New Guinea and Australia where Neanderthal first came from. Not Europe.
Now,(GTCGCTTC) with L-M11 is related to Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
or GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 and M232
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
Message Thread
« Back to index