Abraham and Lilth came from 2 Q1b1a or Q-L245 Tocharian-Sumeria tribes
Posted by Bob Brazilian Mitchell
on December 16, 2012, 8:22 pm
100, 000 ago Q1* came out Levant from Paupa New Guinea people or Rh negative Neanderthal in Levant to Northern China in Xinyang Provine where Q1a with L-M20 existed 40,000 in Tamil Indians and Q1a6 in 8000 years ago 12,000 in Elamo-Dravidian Neolithic farming people in Indus Valley and Nile Valley in Egypt and Ethiopia and Q1ab existed in Sumerians 4000 years ago when the Black Ethiopians with Q1a6 met the Q1a6 Elamite-Dravidian or Tocharian Gutians became the Abraham Jewish of Sumeria 2200 years ago and the ruled for about 100 years and Gutian Tocharians and but chase out the Middle East into Xinyang Province in 2200 B.C. By Babylonians. They were Sumerians Jews with the Sumeria Q1ab Q1b1a or Q-L245 that the Tocharian and and their descendant the Tocharian migrated to from Sumeria with Q1ab. One group went to back Xinyang Province back 2200 B. C. xiaohe the Caucasians She is 3,800 years old with mtDNA R1a1a and Y Chromosome Q1ab with B Rh negative, Tall, Jewish features, Witch Hat, may in fact be Lilith from Ur Sumeria Adam first Q1ab Q1b1a or Q-L245 Tocharian-Sumeria wife who banish by the J1 Babyonian Semitic, They also called them the Gutians who languages related to the Tocharians. So Lilith went to Xinyang Province in Tamir Basin 3800 years ago. Abraham who carried the Q1ab Q1b1a or Q-L245, with B Rh negative blood type who was Wizard when first to Kurdistan from Ur to Levant where Druze were and to Egypt to Yemen where King Solomon is Q1ab, Q1b1a or Q-L245 and B Rh negative in tribe of Judah. The Levite descendant of Abraham from Ur Sumeria. Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch who by 500 B.C. intermarry with L-M20 haplgroup which is 40, 000 years Elamite-Dravidian Medes with Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch like Daniel or Zerubbabel in Cryus the Great with Archamenes Persians and Magi who Daniel who Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch was Chief of Occult Sciences and Rab Mag or Chief the Magi which created L-M11 haplogroup Persian Magi Priesthood in 2500 years when Darius who daughters were mtDNA L-M11 haplogroup or Persian Magi and Persian female Royal lineage which the combination of L-M20 of Medes and Q1b1a or Q-L245 with M-232 and M271 and B Rh negative. My Grandfather Major Frank Warren is L-M20 with L-M11 called L* haplogroup found in the Parsis. We have CdE/cde with B Rh negative from Parsis who from the Na-Dene Blackfoot Sioux Dakota who Cde/cde with A Rh negative and Cde/cde with B Rh negative and in Northeast Asia were Rh negative peak in Asia. B Rh negative mostly with A Rh negative in Xinyang Province in Tocharians in North China came with Q1b1a or Q-L245 xiaohe the Caucasians who B Rh negative and Red Hair, Green Eyes, Tall, Witch and Jewish all like Lilith from Sumeria where Q1b1a or Q-L245 originated 2200 years ago. . She is 3,800 years old, but she still turns heads SEQ ID NO: 800) Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232. This STS also contains M217 site. Q1b1: 5% of Ashkenazi Jewish men are found to be Q1b, of which is my father’s haplogroup (Q1b1a or Q-L245). Q originated in Central Asia 15,000 to 20,000 years ago and the men migrated through northern Eurasia into the Americas. Q3 became Native Americans coming from a mutation that happened 8,000 to 12,000 years ago. Q1b’s are from the Altai Mountains in Mongolia, Siberia and parts of Turkey. Khazaria may be the home of Q1b’s, and therefore these men could be part of the Ashina Royal Dynasty. Their common ancestor was a man 1,000 years ago.
|
|
Message Thread
- Abraham and Lilth came from 2 Q1b1a or Q-L245 Tocharian-Sumeria tribes - Bob Brazilian Mitchell December 16, 2012, 8:22 pm
« Back to index |