As the same time 1800 B.C. the Lilith descendants of Q1a3b left Sumeria same time as Abraham when to the Tamir Basin 1800 B.C. or 3800 years that were find Tamir Mummy called Xiaoche who is infact Lilith the Sumerian-Tocharian Witch and B Rh negative. But what people don't know about the Q1a3b mixed Eurasian Tocharians that live in North America more 12,000 years ago the some Eurasian descents like Caucasian Mummies for in Nevada and Colorado. Which the Native American are afraid to genetic test on because they would they mixed Eurasian Tocharian in North America 12,000 years who survive the Clovis Comet that irradited the whole of North America and the Clovis and Tocharian people and their Bison which DBR3*0101 found both the Bison and B Rh negative Tocharians which cause small Thyroid which both Acromegaly or Nephilism of the Tocharians with Man-Child and Women-Child and the Pituitary Dwarfism or GHRH-R or Growth Hormone Release Hormone Receptor Gene with Pituitary Dwarfism or which is also Man-Child or Women-Child disease for both Jewish and Amerinds family related to Q haplgroup the Tocharian Haplogroup. This created the Super Race or Atlantean people found amoung Jews and Gypsies, Viking and Irish Viking people and Black Irish people. The Tocharian Mummies is Xioche is the Lilith and the Celtic Rhiannon and Irish Danu all form the same Tocharian lineage and the leprechaun is the Pituitary Dwarfism Tocharian lineage or Fye or Farie lineage. The Tocharian Nephilim are the Vampires, and Pituitary Dwarfism are the leprechaun or Fye or Faries which both come for the Tocharian family.
She is usually depicted as a red haired goddess, which makes me like her even more because my natural hair color is red hair, though I dye it a lot now. Hopefully you enjoyed reading this as much as I did writing it. She's one brave Goddess and I can only strive to more like her.
Why this Lilith
1. Tocharian or Gutians invaded Sumeria 2200 B.C.
2. She part of Subeshi witches.
3. She a Shaman woman
4. She pure Jewish Aryan features especially the nose
5. She has Red Hair like Lilith!
6. She is very Tall like Nephilim
7. She is a Caucasian possibly Rh negative.
8. If this not Lilith this is sure a Subeshi Witch family member.
9. Remember the Babylonian came some time after
10. Gutian or Tocharians who became Kurds or are Hell people. Kurd means the Underworld or Hell in Sumeria.
11. Gutian were Black Tocharians who became the Elamite Dravidin or later Persians
12. Tocharian were White B Rh negative Eurasians.
13. Rh with ryr CdE/cde or B Rh negative peak in Northeast Asia where the Tocharians came from as Kagan people.
14.Lilith, Virgin Mary, Goddess Anhita a all B Rh negative like the Sumerian Jews.
15. Tocharian were the Q haplogroup original ancestor of the Jews.
Uncle Ted Kennedy is direclty related to the B R negative Red Hair Rhiannon the Tocharian Celtic and I am too B because I am B Rh negative I have Red hair, Green Eye people in my family which included Vlad Dracula who was Green Eyes.
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
Q1a3b M323 (Yemenite Jews only)
Q1a3b haplogroup (Yemenite Jews) has M271 and M232
L-M11 both Darius Persians Royalty and Yazdegerd III mtDNA L-M11 has M271 and M232
Yazdegerd III mtDNA L-M11 has M271 and M232 in Q haplogroup Kurgans and gtgccttc is the DNA sequence.
This my Grandfather mtDNA : L-M11 DNA sequence and it is Kurgans.
This mine and Virgin Mary or Lilith or Anahita family Kurgan mtDNA sequences.
Let Breaking down plan to you! so you can dig it.
1. Q1a3b that Lilith from Ur
2. Q1a3b Sumerian Tocharian Jews mixed M20 Elamite about 1800 years ago that created the Persian Goddess Anahita
3. Q1a3b or Lilith family was chase of Sumeria as Gutian-Tocharian and Abraham family went to Kurdistan 4000 years ago and later Levant and Yemen with Solomon and Sheba Q1a3b
4. . Q1a3b or Lilith family felled to back to China 4000 years in Tamir Basin in Xinjiang Province of China where you see the . Q1a3b and B rh negative Subeshi Witch.
5. . Q1a3b those same Tall, Jewish Nose, Red Hair, Green Eye, Witch, Witch Hat, and B Rh negative Jewish-Celtic felled to Ireland where is became the Celtic Witch Rhiannon and Irish Danu
6. Q1a3b Sumerian Tocharian Jews mixed M20 Elamite about 1800 years ago that created the Persian Goddess Anahita which create the Parsi L* haplogroup or L-M11 in the Rudari Gypsy and my family.
7. This is why when I went to Ur Sumeria at Tallil Air Force Base or Camp Ali. I and Lilith had a family reunion after 4000 years of separated. And I just happen be born on the day as her twin brother Dumuzi and Lilith Geshtianna you know much less swipe and long be united with her twin brother and husband Dumuzi or Tammuz son of Nimrod.
--Previous Message--
: Chinese Singer Lin Bao is Persian Royalty and
: Vocal Whistler
: Lin Bao
: English Name: BaoBao Lin
: Say: baby
: Nationality: China
: Nationality: Han
: Birth place: Shanghai
: Birthday: January 27th
: Occupation: singer, dancer, dance teacher,
: designer,
: Height: 164cm
: Weight: 46kg
: Constellation: Aquarius
: Blood type: type B
: Zodiac: the horse
: Measurements: 76C or 90,66,92 (CM)
: Language: English, Mandarin, Shanghainese,
: Cantonese (understand)
:
:
: Lin Bao(14 photos)
: English Name: BaoBao Lin
:
:
:
:
:
:
: The 3 moved to Xinjiang (father: Shanghai.
: Mother: Sichuan people. Is the Xinjiang
: youth
: Blood type: type B
:
:
:
:
:
: When compared with the previous ABO blood
: type distribution data of the Uighurs in
: randomly chosen samples, B type in
: RhD-negative individuals was relatively
: higher while A and O types peared lower
:
: To investigate the Rh blood type
: distribution in the Uygur and Han
: nationalities in Khotan area of Xinjiang
: Autonomous Region, China, and compare the
: results with previous documentations on the
: Rh blood type in Uighurs
: Following the invasion of Iran by Muslim
: Arabs, Pirooz, son of Yazdegerd III, escaped
: along with a few Persian nobles and took
: refuge in the Chinese imperial court. Both
: Piroz and his son Narsieh (Chinese neh-shie)
: were given high titles at the Chinese court.
: At least in two occasions, last one possibly
: in 670, Chinese troops were sent with Pirooz
: in order to restore him to the Sassanid
: throne with mixed results, one possibly
: ending up in a short rule of Pirooz in
: Sistan (Sakestan) from which we have a few
: remaining numsmatic evidence. Narsieh later
: attained the position of commander of the
: Chinese imperial guards and his descendants
: lived in China as respected princes.
:
:
:
:
: Abstract
: OBJECTIVE:
: To investigate the Rh blood type
: distribution in the Uygur and Han
: nationalities in Khotan area of Xinjiang
: Autonomous Region, China, and compare the
: results with previous documentations on the
: Rh blood type in Uighurs.
: METHOD:
: Using epidemiological methods, an extensive
: survey was conducted for determination of
: the Rh blood type in 2,907 residents in the
: target area, including 2,251 Uighurs and 656
: subjects of Han nationality. Positive
: definition method was used for the ABO blood
: typing while Rh blood type was determined
: serologically through saline medium method.
: At the same time, the Rh phenotypes were
: investigated in RhD-negative individuals.
: RESULTS:
: Altogether 106 RhD-negative individuals were
: identified, accounting for a rate of 4.71%
: in this cohort, with the D gene frequency of
: 0.217. The Rh phenotype of all RhD-negative
: cases were ccdee except for one that was
: ccdEe. When compared with the previous ABO
: blood type distribution data of the Uighurs
: in randomly chosen samples
:
:
: , B type in RhD-negative individuals was
: relatively higher while A and O types peared
: lower.
:
:
:
:
: CONCLUSION:
: The Rh blood type frequency is relatively
: higher in the Uighurs with unique Rh
: phenotypes.
:
:
:
: Following the invasion of Iran by Muslim
: Arabs, Pirooz, son of Yazdegerd III, escaped
: along with a few Persian nobles and took
: refuge in the Chinese imperial court. Both
: Piroz and his son Narsieh (Chinese neh-shie)
: were given high titles at the Chinese court.
: At least in two occasions, last one possibly
: in 670, Chinese troops were sent with Pirooz
: in order to restore him to the Sassanid
: throne with mixed results, one possibly
: ending up in a short rule of Pirooz in
: Sistan (Sakestan) from which we have a few
: remaining numsmatic evidence. Narsieh later
: attained the position of commander of the
: Chinese imperial guards and his descendants
: lived in China as respected princes.
: The standard Romanization of the Saraiki
: language name (at least de facto) is
: "Saraiki". However,
: "Seraiki", and "Siraiki"
: have also been used in academia until
: recently.
: The Sarikoli language (also Sariqoli,
: Selekur, Sarikul, Sariqul, Sariköli) is a
: member of the Pamir subgroup of the
: Southeastern Iranian languages spoken by
: Tajiks in China
:
:
:
: Lin Bao is Natural Castrato like me, her
: mother is from the Xinjiang both were when
: the Persian Royal family of Pirooz who is B
: Rh negative and also the descendant of the
: Tocharian Mummie who also B Rh negative
: hence a high B Rh negative frequency in
: Xinjiang Province where Lin Bao from. Pirooz
: is the son of Yazdegerd III is the sister of
: Nazbanu from Pars and Parsis who I come
: directly from and Both them B Rh negative
: just Lin Bao and I are B Rh negative carrier
: and Natural Castrato with GHRH-R or Growth
: Hormone Release Hormone Receptor gene or
: Male or Female limited Precious Puberty
: called the Dwarfism of Sindh in Karachi in
: which the female mtDNA descendant L*
: haplogroup from Parsis which effect
: longevity and maturation at 1 or 2 year;
: hences preserve the Colotura or Rh negative
: Aryan Bass to Soprano voice which natural of
: Rh negative Aryan boy or Girl that come
: these Noble Persian and Jews, Gypsy and
: Amerinds families. Plus the Persian is
: spoking in the Xinjiang Province by Tajik
: which popuation is 13,000 and this the
: original tribe that Yazdegerd III son Pirooz
: came from Sistan where the spoke the Jat or
: Banu Sassan langauge of Saraikoli which is
: the same or similar language the Sindhi and
: Punjabi Persian language or Saraiki the
: gypsy language.
:
Message Thread
« Back to index