on July 22, 2013, 9:34 am
"Mitochondrial DNA Variability in Slovaks, with Application to the Roma Origin"
http://onlinelibrary...07.00410.x/full
"Previously, we have found that the Polish Roma population is characterized by high incidence (18.8%) of haplogroup J1* lineage, defined by HVS I motif 16069–16126-16145–16222-16235–16261-16271 (Malyarchuk et al. 2006a). This and a similar haplotype, lacking only the 16271 transition, are very rare in European Roma populations, being found only in the Spanish, Bulgarian and Hungarian Roma (Gresham et al. 2001; Egyed et al. 2007).
Among Europeans, such haplotypes have been revealed only in French (0.5%; Dubut et al. 2004), Hungarian (0.5%; Egyed et al. 2007) and Czech (about 3%; Vanecek et al. 2004; Malyarchuk et al. 2006b) populations.
In the present study, we have found that 2.9% of individuals from eastern Slovakia are characterized by exactly the same J1*-haplotype. Taking into account its similarity with J1-haplotypes revealed in Southwestern Pakistani populations (Quintana-Murci et al. 2004) and thus assuming that this haplotype might have been characteristic of the ancestral Romani population (Malyarchuk et al. 2006a), we completely sequenced two J1*-samples revealed in Slovakia (Fig. 2). Comparison with published data (pooled in MitoMap mtDNA tree (Ruiz-Pesini et al. 2007)) demonstrated that these J1*-haplotypes belong to a new subhaplogroup J1a defined by transition at 8460.
This subhaplogroup appears to be a sister clade to subhaplogroup J1b. Therefore, the J1a contribution to the Roma, and through them to some European gene pools, can be caused by gene flow from Indo-Pakistani region.
One of the haplogroup J Slovak sample (Slv174; 16069–16126–16261–73–263–295) was characterized by uncertain HVS II motif, due to the lack of any subhaplogroup-diagnostic mutation according to classification developed in Palanichamy et al. (2004) and Carelli et al. (2006). To determine its phylogenetic status, we completely sequenced this sample and found that it belongs to subhaplogroup J1c being accompanied by transition at 14798, despite the lack of diagnostic mutation at position 228. It is unclear however, whether this sample should occupy the ancestral node for J1c-phylogeny or it is the result of back-mutation at position 228 (Fig. 2)."
The Quintana-Murci article regarding J1 being found in Baloch and other Pakistani population is here:
Then there is the work of Dr. Doron Behar, who is on the Board of FTDNA and in speaking of Iranians, refers to "The Iraqi Jewish mtDNAswithin Hg J1 had the hallmark of control region haplotype 16069-16126-16145-16222-16261- 73-263-295
mtDNA haplotypes in Slovak populations include Roma gypsies
69 126 145 222 235 261 271 73 263 295 309iC J1a E(2)
69 126 145 222 235 261 271 73 263 295 309iC 315iC J1a E(1)
69 126 145 222 235 261 271 290 73 263 295 309iC 315iC J1a E(1)
69 126 145 172 222 261 73 242 263 295 309iC 315iC J1b1 W(1)
69
Theses are mtDNA from Kalderash Siaewi
73 263 295 309i
Your Official Report
Your mtDNA results have been successfully added to the Ancestry.com DNA database. You may now explore how your results match with others, join a DNA Group, or add your DNA results to your family tree.
LOCATION 73 150 195 263 315.1 16223 16320 16519
REFERENCE A C T A : C C T
Major Frank Warren G T C G C T T C
haplogroup K2-M70, which I believe to be closely related to haplogroup L-M11
Dienekes Pontikos wrote:
> > Haplogroup L-M11 is frequent in parts of the
> Caucasus, and it was
> > found at a frequency of around 5% in Calabria, as
> well as in Greece,
> > Turkey, Georgia, Hungary, etc.
>
> Actually, L-M11 is the prominent Haplogroup of
> Indo-Iranians. In days of
> Darius I, the Medo-Persians (in other words
> Indo-Iranians) established
> intensive administratve presence in many parts of
> Greek World.
>
> Dienekes Pontikos wrote:
> > Presumably L could have arrived to Southern Italy
> by either Neolithic
> > farmers, or the Greeks.
>
> There is no need to stipulate the "Neolitic" sources
> for the expansions
> which are well documented in the recorded history of
> relatively recent
> times. In the case of L-M11, it is the Persian
> Conquest of Eastern
> Mediterranean.
>
> Likewise, K2-M70 is distributed across the areas
> related to Greek
> civilization.
> Actually, L-M11 is the prominent Haplogroup of Indo-Iranians. In days of
> Darius I, the Medo-Persians (in other words Indo-Iranians) established
> intensive administratve presence in many parts of Greek World.
tatistical Analysis
The DNA sequences were aligned using Clustal X ver. 1.81. (Thompson et al. 1997). The MEGA program (Kumar et al. 1994) was employed to identify each haplotype using the complete deletion option, with no assumption of traditional haplotypes definition. In this way 278 nucleotidic positions were conserved (for each of the 322 individuals studied for the analysis of Gurna vs. other Nile valley populations) and 281 nucleotide positions were conserved (for each of the 890 individuals studied for the analysis of Gurna vs. Near East populations). The genetic structure of the population was analyzed using AMOVA (24) and F or φ statistics (Excoffier et al. 1992; Weir & Cokerham, 1984) of various populations using the Arlequin 2.0 program (Schneider et al. 2000). We estimated the genetic variation attributable to differences among localities using pre-specified hierarchical groups (φsc), among localities across the entire study area (φst), and among pre-specified hierarchical groups (φct).
An exact test of population differentiation was performed using a Markov chain with 1000 iterations. The Kimura 2P distance option was selected.
The pairwise Fst can be used to describe the short-term genetic distance between populations, with the application of a slight transformation to linearize the distance with population divergence time (Reynolds et al. 1983). A phenogram based on 12 populations using Fst values (on a matrix of coancestry coefficients (Reynolds et al. 1983)) and the Neighbor-Joining (NJ) (Saitou & Nei, 1987) clustering algorithm was calculated. A control population (South African Bantu speaking population, Soodyall et al. 1996) was used as an outgroup.
A network was drawn using the TCS 1.13 package. This is a method that connects existing haplotypes in a minimum spanning tree, which is essentially a parsimony method. This method starts calculating the overall limits of parsimony for the complete data set using a statistic from neutral coalescent theory (Hudson, 1989). The phylogenetical reconstruction algorithm was described in (Templeton et al. 1992).
Results
Sequence Data of Gurna Population
Both hypervariable segments (HV1 and HV2) of the control region were sequenced. Sequence polymorphisms and results of RFLP analysis are reported in Table 1 for the 34 individuals from Gurna. Sequence polymorphisms of the HV1 Region for the 24 individuals from Upper Egypt are reported in Table 2.
Table 1. Sequence polymorphisms of the Control Region, RFLP analysis and Haplogroups of Gurna Subject ID# HVS-I variation(a) HVS-II variation(a) Diagnostic RFLP markers Haplogroup
GUR23 16140, 16218 − −7025 AluI H
GUR27 − − −7025 AluI H
GUR31 16209C, 16210, 16224 152C/T −7025 AluI H
GUR44 − 146 −7025 AluI H
GUR48 16148, 16256, 16304, 16390 − −7025 AluI H
GUR34 16093, 16129, 16223, 16391 73, 152C/T, 199, 204 +10032 AluI I
GUR39 16129, 16223, 16391 73, 199, 204 +10032 AluI I
GUR22 16069, 16126, 16193, 16300, 73, 152 −13704 Bst0I J
16309
GUR26 16066T, 16069, 16093, 73, 150, 152, 185 −13704 Bst0I J
16126, 16193
GUR2, 16129, 16148, 16168, 16172, 64, 93, 152, 185, +3592 HpaI, +11641 L1a
GUR15, 16187, 16188G, 16189, 16223, 189, 200 HaeIII
GUR63 16230, 16311, 16320
GUR8 16129, 16148, 16168, 16172, 64, 93, 185, 189, +3592 HpaI, +11641 L1a
16187, 16188G, 16189, 200 HaeIII
16223, 16230, 16294G,
16311, 16320
GUR18 16129, 16148, 16166, 16187, 73, 182, 195 +3592 HpaI, +10806 L1e
16189, 16223, 16278, 16290, HinfI, +12810 RsaI
16360, 16390
GUR32 16129, 16148, 16166, 73, 182, 195 +3592 HpaI, +10806 L1e
16187,16189, 16223, 16278, HinfI, +12810 RsaI
16290, 16311, 16360, 16390
GUR33 16183C, 16189, 16278, 73, 146, 152, 195 +3592 HpaI, +13803 L2a
16294,16390 HaeIII
GUR19 16223, 16311, 16362 73, 150 −2349 MboI, +8616 L3*
MboI, −10084 TaqI, −10394
DdeI, −10871 MnlI
GUR21 16104, 16181C, 16182C, 73, 146, 153 +10871 MnlI, −11718 HaeIII(b), L3*
16183C, 16189, 16311 −12308 HinfI(c)
GUR37 16126, 16214, 16231, 16311 73, 150, 195 +10394 DdeI, +10871 MnlI, L3*
−11718 HaeIII(b), −12308
HinfI(c)
GUR46 16169, 16193, 16195, 16266, 73, 150, 152 +10394 DdeI L3*
16301
GUR7 16093, 16120T, 16129, 73, 195 +10397 AluI M1
16183C, 16189, 16223,
16311, 16359
GUR14 16129, 16189, 16223, 16249, 73, 146, 195 +10397 AluI M1
16261, 16311, 16359
GUR20 16129, 16183C, 16189, 73, 195 +10397 AluI M1
16223, 16311, 16359
GUR12 16129, 16183C, 16189, ND (d) +10397 AluI M1
16223, 16249, 16311
GUR29 16189, 16223, 16292, 73, 195 +10397 AluI M1
16293C, 16311, 16359
GUR35 16085G, 16129, 16183C, 73, 195, 210C +10397 AluI M1
16189, 16223, 16249, 16311
GUR17, 16145, 16176G, 16223, 73, 152 +10237 HphI, +10871 N1b
GUR40 16390 MnlI
GUR28 16126, 16145, 16176G, 73, 152, 195 +10237 HphI, +10871 N1b
16223, 16390 MnlI
GUR3 16126, 16294, 16296, 16324 73, 195 +13366 BamHI T
GUR57 16126, 16146, 16172, 16239, 73, 146, 195 +13366 BamHI, +4216 NlaIII T3
Subject ID# HVS-I variation(a) HVS-II variation(a) Diagnostic RFLP markers Haplogroup
(a)Relative to the CRS (Anderson et al. 1981). Mutations are transitions unless the base change or an indel is specified explicitly. Nucleotide positions followed by C/T indicate heteroplasmy.
(b)Using the mismatched primer described in Richards et al. 2000.
(c)Using the mismatched primer described in Torroni et al. 1996.
(d)ND: Not determined.
The Gurna were Jews form Goshen or Thebes and they came to Egypt in the 18th Dynasty introduce eygpt to the Underworld and Osiris and Sekmet and Bestan the Cat People or Vampire at the city and Temples of Thebes were they came from 2800 D.C. in the 18th Dynasty of Amenhotep I when made contact with Babylonians or Sumerian Jewish people or the Gurna. The Gurna people have 6519, 73 and 195) or 73, 150, 195 which Jewish-Egyptian Markers the Gurna were the Rh negative Gurna jewish Pharaoh but they are the original ancestor of the Gypsy people who have
"Mitochondrial DNA Variability in Slovaks, with Application to the Roma Origin"
http://onlinelibrary...07.00410.x/full
"Previously, we have found that the Polish Roma population is characterized by high incidence (18.8%) of haplogroup J1* lineage, defined by HVS I motif 16069–16126-16145–16222-16235–16261-16271 (Malyarchuk et al. 2006a). This and a similar haplotype, lacking only the 16271 transition, are very rare in European Roma populations, being found only in the Spanish, Bulgarian and Hungarian Roma[/b] (Gresham et al. 2001; Egyed et al. 2007).
Among Europeans, such haplotypes have been revealed only in French (0.5%; Dubut et al. 2004), Hungarian (0.5%; Egyed et al. 2007) and Czech (about 3%; Vanecek et al. 2004; Malyarchuk et al. 2006b) populations.
K2-M70 is 12 % in Medellin Columbia
Heteroplasmy in 73 195 150 in Gurna who Egyptian Jewish Pharaohs in the 18th Dynasty form Amenhotep I to Amenhotep IV or Akhanton or Ramesis II who may one last B Rh negative blood type Tocharian Jewish Pharaoh.
If the Gurna were Rh negative and Pharaohs is means that Gypsies or Pure Gypsies like family come from Yazdgerd III who was J1a or J1b which the Jewish Exilarch hypervariables haplotype 16069-16126-16145-16222-16261- 73-263-295
The Y-Chromosome of Yazdegerd III was J1b o the Jewish Exlarch 16069-16126-16145-16222-16261- 73-263-295
mtDNA of Yazdegerd III daughter Nazbanu is L-M11 which close related K2-M70 in form Jewish Gurna people of Egypt and the Jewish Exilarch or Jewish Royalty form the tribe of Judah. and Benjamin
GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.
K-M9, K2-M70 and L-M11 and HTLV-Ipx or Sp40 which cause insentive Laron Syndrome in the Homo Floresiensis or Homo Hobbit the 1.8 million year old Neanderthal in Malaysia in Southeast Asia both fa;b0b2b3b4b5bst and f;b0b2b3b4bst both all originated in Negrito M9 peoples.
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
mtDNA 271 or 16271 in found in the Semang in Malaysia
This clearly shows that Gurna are the Pharaoh people and the original ancestor of Jewish and especially the Gypsies people who did infact originate from Egypt from the Land of Goshen in Thebes with Gurna people who both Sekmet and Bastet or Cat or Vampire people.
Message Thread
« Back to index