Q1a3b Abraham was one of the very first Kabbalists, some 3800 years ago from Ur Sumeria.
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.
Q1a 3b Subeshi Witches or Tocharian-Jewish or Lilith arrive to the Tamir Basin 3800 years ago from Ur Sumeria ...
This is the real Rhiannon or Lilith, Tall, Jewish Nose, Red Hair, Green Eye, Witch, Witch Hat, and B Rh negative Jewish-Celtic Witch an pure Cacacasian with Q1b same as the father all Jews Abraham and ...
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
[Comparative investigation of the Rh blood type distribution between the Uygur and Han nationalities in the Khotan area of Xinjiang Autonomous Region].
[Article in Chinese]
Kurexijiang T, Hamulati W, Nuermaimaiti Y, Muyasaier K, Palida Habaer R, Halike Y, Meilike Y, Zhang LZ, Maimaitiabula A.
Source
People's Hospital of Hetian County, Hetian 848100, Xinjiang Autonomous Region, China.
Abstract
OBJECTIVE:
To investigate the Rh blood type distribution in the Uygur and Han nationalities in Khotan area of Xinjiang Autonomous Region, China, and compare the results with previous documentations on the Rh blood type in Uighurs.
METHOD:
Using epidemiological methods, an extensive survey was conducted for determination of the Rh blood type in 2,907 residents in the target area, including 2,251 Uighurs and 656 subjects of Han nationality. Positive definition method was used for the ABO blood typing while Rh blood type was determined serologically through saline medium method. At the same time, the Rh phenotypes were investigated in RhD-negative individuals.
RESULTS:
Altogether 106 RhD-negative individuals were identified, accounting for a rate of 4.71% in this cohort, with the D gene frequency of 0.217. The Rh phenotype of all RhD-negative cases were ccdee except for one that was ccdEe. When compared with the previous ABO blood type distribution data of the Uighurs in randomly chosen samples, B type in RhD-negative individuals was relatively higher while A and O types peared lower.
CONCLUSION:
The Rh blood type frequency is relatively higher in the Uighurs with unique Rh phenotypes.
PMID:
15090322
[PubMed - indexed for MEDLINE]
Free full text
Q1a3b M323 (Yemenite Jews only)
Rhiannon or Lilith the Tocharian cannot marry mortals of she will lose her powers but she married me in Ur Sumerian the homeland of the Gutian-Tocharian with B Rh negative both Arbaham father of Jews or Ahura Mazda with Q1a3b Gutian-Tocharian and Lilith or Belita the Mother of all were both with Q1a3b Gutian-Tocharian and B Rh negative people from the Tamir Basin in China
Historical Aspect:
The Yemeni Jews formation: in Yemenite Jews
6. Q1b Q1b into Caucasians, mainly in Europe, also has some distribution in Xinjiang, China, South Asia, North Africa. The figure above the main migratory routes is a reference to a European direction Q distribution A detailed map and do. Facebook Q1b one user said: the his ancestors sources is about 3,000 years movement from the eastern Mediterranean, the Levant and North Africa, a family.
Historical Aspect: Ashkenazi Jews ( Ashkenazi, Jewish ) Zionism Jews ( Mizrachi Jewish ), the Iberian Peninsula, Jews ( Sephardi Jewish ), the Ashina Turkic people, the Vikings, Vikings, Masonic
Europe
Q1b as a unique genetic markers, and may be related with the Green Turkic Ashina's Khazar Asna's Ashkenazi Jews, has attracted wide attention. Familytreedna subjects to establish a "ASHINA / A-SHIH-NA / ASENA ROYALTY (OF GOKTURKS AND KHAZARS) DNA" (translated: young Turks and Khazar royal A History of Nashi DNA) project, has brought together 43 cases Q1b samples (some of which are not measured defined Q1b SNP loci STR structure speculate Q1b M378) (connection). At the same time, some subjects were established "Jewish_Q - YDNA Haplogroup Q1b of European Descent" (translated: Jews _Q: European descent, Y-DNA the haploid group Q1b), currently brings together 134 cases Q1b or suspected Q1b samples (connection).
172 This study Xinjiang Uygur Q1b-M378 Q1b 13 12 14 16 21 10 15 13
173 This study Xinjiang Uygur Q1b-M378 Q1b 13 12 13 16 22 10 15 13
174 Sengupta,et al.2006 Pakistan_North Q1b-M378 Q1b 13 12 13 16 22 10 15 13
175 Sengupta,et al.2006 Pakistan_South Q1b-M378 Q1b 13 12 14 16 22 10
15 13
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.
2009 literature "A Y-STR database of Iranian and Azerbaijanian minority populations" reports, the researchers were 46 cases of ethnic minorities in Iran, Arab sample, 46 cases Bakhtiari samples in each of the 43 cases Talysh samples found in 1 case Q1b.
2009 Another paper, "Local Population Structure in Arabian Peninsula Revealed by Y-STR Diversity" reported that the UAE sample of 217 cases, the researchers found three cases Q1b, and found 104 cases of Iranian sample one cases Q1b.
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.
2009 literature "A Y-STR database of Iranian and Azerbaijanian minority populations" reports, the researchers were 46 cases of ethnic minorities in Iran, Arab sample, 46 cases Bakhtiari samples in each of the 43 cases Talysh samples found in 1 case Q1b.
Sasan the brother of the Darius III became a Shepherd in the Baktiarin region with Q1b-M278 that became the L-M11 haplogroup the mtDNA Sassanian Nobles when LM20 of the Elamites or Magi priest or Medes mixed with Jewish Persian of Sasan Q1b-M278 became the Parsis Noble Royal and Priestly class Sassanians in 200 A.D. when the Parsi Priesthood began 1800 years ago. Sasan descend from Darius and Cyrus the Great and he was the Jewish Q1b-M278 which came from Esther who Cyrus the Great Wife and Darius I who was their son. My Grandfather Major Frank Warren has the Parsis mtdna Nobles form Parsis L-M11 haplogroup with B rh negative both who came Nazbanu the daughter of Yazdegerd III daughter mtDNA L* and B Rh negative types.
Q1b caused widespread concern from the 2004 literature "Y chromosome evidence for a founder effect in Ashkenazi Jews", this article analyzed 495 cases of Ashkenazi Jewish paternal genetic deconstruction results found Q1b occurrence frequency of 5%, it is also measured to a certain percentage of the East Eurasian haplotype C, N, and therefore, presumably Q1b may be related to the East Eurasian populations. A the ASHG 2010 Conference literature "Population Genetic Analysis of a Large Ashkenazi, Jewish" According to a summary, the researchers detected a large sample of more than 1000 cases of Ashkenazi Jews, but unfortunately has been no original contains not clear how much Q1b sample .
When compared with the previous ABO blood type distribution data of the Uighurs in randomly chosen samples, B type in RhD-negative individuals was relatively higher while A and O types peared lower.
Message Thread
« Back to index