--Previous Message--
: The Tocharians were originally Q1b and B Rh
: negative Jews.
: Q1a3b Abraham was one of the very first
: Kabbalists, some 3800 years ago from Ur
: Sumeria.
:
:
:
: According to the 2010 recent literature
: "Extended Y-chromosome investigation
: _Suggests_ to post-Glacial migrations of
: modern that perfecting a into East Asia via
: the northern route," reports, the
: research team in Xinjiang No. 106 sites 18
: cases Uighur samples measured five cases
: Q1b-M378 and in Xinjiang No. 105 locations
: in 71 specimens, measured one cases
: Q1b-M378, but not seen Q1b-M378 in the
: Uighur samples of 104 and 107 at two
: locations, and other ethnic groups examined
: samples nor See Q1b-M378. From the
: previously published literature, no the
: domestic ethnic measured to Q1b-M378. It
: would appear that in China Q1b-M378 is
: focused on a specific ethnic group in
: Xinjiang.
:
:
:
: Q1a 3b Subeshi Witches or Tocharian-Jewish
: or Lilith arrive to the Tamir Basin 3800
: years ago from Ur Sumeria ...
:
:
: This is the real Rhiannon or Lilith, Tall,
: Jewish Nose, Red Hair, Green Eye, Witch,
: Witch Hat, and B Rh negative Jewish-Celtic
: Witch an pure Cacacasian with Q1b same as
: the father all Jews Abraham and ...
:
:
: Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID
: NO: 801) M271 = UTY1 intron 17 3679-566 (461
: bp) A to C at position 296 GroupVIII.
: Discovered while typing M232
:
:
: [Comparative investigation of the Rh blood
: type distribution between the Uygur and Han
: nationalities in the Khotan area of Xinjiang
: Autonomous Region].
: [Article in Chinese]
: Kurexijiang T, Hamulati W, Nuermaimaiti Y,
: Muyasaier K, Palida Habaer R, Halike Y,
: Meilike Y, Zhang LZ, Maimaitiabula A.
: Source
: People's Hospital of Hetian County, Hetian
: 848100, Xinjiang Autonomous Region, China.
:
:
:
: Abstract
: OBJECTIVE:
: To investigate the Rh blood type
: distribution in the Uygur and Han
: nationalities in Khotan area of Xinjiang
: Autonomous Region, China, and compare the
: results with previous documentations on the
: Rh blood type in Uighurs.
: METHOD:
:
:
: Using epidemiological methods, an extensive
: survey was conducted for determination of
: the Rh blood type in 2,907 residents in the
: target area, including 2,251 Uighurs and 656
: subjects of Han nationality. Positive
: definition method was used for the ABO blood
: typing while Rh blood type was determined
: serologically through saline medium method.
: At the same time, the Rh phenotypes were
: investigated in RhD-negative individuals.
: RESULTS:
:
:
: Altogether 106 RhD-negative individuals were
: identified, accounting for a rate of 4.71%
: in this cohort, with the D gene frequency of
: 0.217. The Rh phenotype of all RhD-negative
: cases were ccdee except for one that was
: ccdEe. When compared with the previous ABO
: blood type distribution data of the Uighurs
: in randomly chosen samples, B type in
: RhD-negative individuals was relatively
: higher while A and O types peared lower.
: CONCLUSION:
: The Rh blood type frequency is relatively
: higher in the Uighurs with unique Rh
: phenotypes.
: PMID:
: 15090322
: [PubMed - indexed for MEDLINE]
: Free full text
:
:
:
:
:
:
: Q1a3b M323 (Yemenite Jews only)
:
:
: Rhiannon or Lilith the Tocharian cannot
: marry mortals of she will lose her powers
: but she married me in Ur Sumerian the
: homeland of the Gutian-Tocharian with B Rh
: negative both Arbaham father of Jews or
: Ahura Mazda with Q1a3b Gutian-Tocharian and
: Lilith or Belita the Mother of all were both
: with Q1a3b Gutian-Tocharian and B Rh
: negative people from the Tamir Basin in
: China
: Historical Aspect:
:
:
: The Yemeni Jews formation: in Yemenite Jews
: 6. Q1b Q1b into Caucasians, mainly in
: Europe, also has some distribution in
: Xinjiang, China, South Asia, North Africa.
: The figure above the main migratory routes
: is a reference to a European direction Q
: distribution A detailed map and do. Facebook
: Q1b one user said: the his ancestors sources
: is about 3,000 years movement from the
: eastern Mediterranean, the Levant and North
: Africa, a family.
: Historical Aspect: Ashkenazi Jews (
: Ashkenazi, Jewish ) Zionism Jews ( Mizrachi
: Jewish ), the Iberian Peninsula, Jews (
: Sephardi Jewish ), the Ashina Turkic people,
: the Vikings, Vikings, Masonic
: Europe
:
:
: Q1b as a unique genetic markers, and may be
: related with the Green Turkic Ashina's
: Khazar Asna's Ashkenazi Jews, has attracted
: wide attention. Familytreedna subjects to
: establish a "ASHINA / A-SHIH-NA / ASENA
: ROYALTY (OF GOKTURKS AND KHAZARS) DNA"
: (translated: young Turks and Khazar royal A
: History of Nashi DNA) project, has brought
: together 43 cases Q1b samples (some of which
: are not measured defined Q1b SNP loci STR
: structure speculate Q1b M378) (connection).
: At the same time, some subjects were
: established "Jewish_Q - YDNA Haplogroup
: Q1b of European Descent" (translated:
: Jews _Q: European descent, Y-DNA the haploid
: group Q1b), currently brings together 134
: cases Q1b or suspected Q1b samples
: (connection).
:
:
: 172 This study Xinjiang Uygur Q1b-M378
: Q1b 13 12 14 16 21 10 15 13
: 173 This study Xinjiang Uygur Q1b-M378
: Q1b 13 12 13 16 22 10 15 13
: 174 Sengupta,et al.2006 Pakistan_North
: Q1b-M378 Q1b 13 12 13 16 22 10 15
: 13
: 175 Sengupta,et al.2006 Pakistan_South
: Q1b-M378 Q1b 13 12 14 16 22 10
: 15 13
:
:
: According to the 2010 recent literature
: "Extended Y-chromosome investigation
: _Suggests_ to post-Glacial migrations of
: modern that perfecting a into East Asia via
: the northern route," reports, the
: research team in Xinjiang No. 106 sites 18
: cases Uighur samples measured five cases
: Q1b-M378 and in Xinjiang No. 105 locations
: in 71 specimens, measured one cases
: Q1b-M378, but not seen Q1b-M378 in the
: Uighur samples of 104 and 107 at two
: locations, and other ethnic groups examined
: samples nor See Q1b-M378. From the
: previously published literature, no the
: domestic ethnic measured to Q1b-M378. It
: would appear that in China Q1b-M378 is
: focused on a specific ethnic group in
: Xinjiang.
:
:
: 2009 literature "A Y-STR database of
: Iranian and Azerbaijanian minority
: populations" reports, the researchers
: were 46 cases of ethnic minorities in Iran,
: Arab sample, 46 cases Bakhtiari samples in
: each of the 43 cases Talysh samples found in
: 1 case Q1b.
:
:
:
: 2009 Another paper, "Local Population
: Structure in Arabian Peninsula Revealed by
: Y-STR Diversity" reported that the UAE
: sample of 217 cases, the researchers found
: three cases Q1b, and found 104 cases of
: Iranian sample one cases Q1b.
: According to the 2010 recent literature
: "Extended Y-chromosome investigation
: _Suggests_ to post-Glacial migrations of
: modern that perfecting a into East Asia via
: the northern route," reports, the
: research team in Xinjiang No. 106 sites 18
: cases Uighur samples measured five cases
: Q1b-M378 and in Xinjiang No. 105 locations
: in 71 specimens, measured one cases
: Q1b-M378, but not seen Q1b-M378 in the
: Uighur samples of 104 and 107 at two
: locations, and other ethnic groups examined
: samples nor See Q1b-M378. From the
: previously published literature, no the
: domestic ethnic measured to Q1b-M378. It
: would appear that in China Q1b-M378 is
: focused on a specific ethnic group in
: Xinjiang.
:
:
:
: 2009 literature "A Y-STR database of
: Iranian and Azerbaijanian minority
: populations" reports, the researchers
: were 46 cases of ethnic minorities in Iran,
: Arab sample, 46 cases Bakhtiari samples in
: each of the 43 cases Talysh samples found in
: 1 case Q1b.
:
: Sasan the brother of the Darius III became a
: Shepherd in the Baktiarin region with
: Q1b-M278 that became the L-M11 haplogroup
: the mtDNA Sassanian Nobles when LM20 of the
: Elamites or Magi priest or Medes mixed with
: Jewish Persian of Sasan Q1b-M278 became the
: Parsis Noble Royal and Priestly class
: Sassanians in 200 A.D. when the Parsi
: Priesthood began 1800 years ago. Sasan
: descend from Darius and Cyrus the Great and
: he was the Jewish Q1b-M278 which came from
: Esther who Cyrus the Great Wife and Darius I
: who was their son. My Grandfather Major
: Frank Warren has the Parsis mtdna Nobles
: form Parsis L-M11 haplogroup with B rh
: negative both who came Nazbanu the daughter
: of Yazdegerd III daughter mtDNA L* and B Rh
: negative types.
:
:
:
:
: Q1b caused widespread concern from the 2004
: literature "Y chromosome evidence for a
: founder effect in Ashkenazi Jews", this
: article analyzed 495 cases of Ashkenazi
: Jewish paternal genetic deconstruction
: results found Q1b occurrence frequency of
: 5%, it is also measured to a certain
: percentage of the East Eurasian haplotype C,
: N, and therefore, presumably Q1b may be
: related to the East Eurasian populations. A
: the ASHG 2010 Conference literature
: "Population Genetic Analysis of a Large
: Ashkenazi, Jewish" According to a
: summary, the researchers detected a large
: sample of more than 1000 cases of Ashkenazi
: Jews, but unfortunately has been no original
: contains not clear how much Q1b sample .
:
:
:
: When compared with the previous ABO blood
: type distribution data of the Uighurs in
: randomly chosen samples, B type in
: RhD-negative individuals was relatively
: higher while A and O types peared lower.
:
:
Message Thread
« Back to index