on April 8, 2013, 9:23 am
fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- and B- Rh negative with also carry Laron Syndrome of B Rh negative with H3 haplogroup or subtype 271
GHRH-R or insensitive Laron Syndrome protect against various cancers.
DRB3*0101 and DR52a from Gorrilla or Homo Erectus Neanderthal
B blood some protect against HIV
B Rh negative have great protect agianst HIV
mtDNA L-M11 trace roots to Darius the Great of Persia and Zoroaster Arianoi or pure Aryan.
J1b trace to the Sumerians Ychromosome Jewish Exilarch or King all the Jewish and tribe of Judah and Benjamin.
B Rh negative traces to tribe of Judah and Benjamin, Lilith, Samael, or Anahita or Ahura Mazda, Daniel or Zerubbabel and Virgin Mary.
DRB1*0802 trace to Blackfeet Sioux and Mayan Amerindians.
Rh ryr trace to Native American Rh negative people such as Aluet who B- Rh negative, Blackfeet Indian who are A- Rh ryr negative and Andes Indian who B- Rh ryr negatives.
In Asia it is the Japanese Ural-Altaic (ighg 1G3 fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- or pure Caucasian race people.
GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
mtDNA 271 or 16271 in found in the Semang in Malaysia
Virtually all of this reaearch has been done by non-LDS scientists, which is the best way to let the truth come out as it eventually will.
H3 represents a smaller fraction of European genome than H1 but has a somewhat similar distribution with peak among Basques (13.9%), Galicians (8.3%) and Sardinians (8.5%). Its importance decreases towards the northeast of the continent though.[1] Studies have suggested haplogroup H3 is highly protective against AIDS progression.[12]
M271 is a new member of Subgroup H3.
mtDNA M271 originated Mainland Southeast Asia Negritos with the CDe or fa;b0b2b3b4b5tCDe found both in Malaysia Negritos and Amerindians.
With this Formula you with pure Caucasian Neanderthal Rh negative blood with various protection natural protect with Cancers and HIV and pure Aryan features form the Jews.
You have foutain of youth because you will have GHRH-R or insensitive Laron Syrdome which will normal child protection and but maturation will occur at the of 2 or 3 years old and young and old charatheristic will be totally preserved for life. You will age very slowly and live longer and with all the protect of against HIV and Cancers and other diseases. You will be a Super no African no Chimpanzee race of people.
Message Thread
« Back to index