I to my Persian Royal family 2500 years to form our Pars Persian Caste with Rh ryr B Rh negative. it take you several more generation of Hybriding but in the futur there will many Rh negative Rh ryr negative caste and Southeast Rh CDe Southeast Asia caste among the Asians, Oceania and Amerinds, so of who similar benefit as the Rh ryr Rh negative caste among dwarf Amerindian people of Andes and Aztec and Mayans. Latinos are are the perfect to people form Rh negative and Southeast Asia caste because being a of Basques, Jewish and Gypsy origins and Mayan and Aztec and Inca Origins. Forum Rh ryr B Rh negative caste A- Rh ryr Rh negative and O Rh ryr Rh negative Caste and AB- Rh ryr Rh negative caste are very possible about the Latino people who carry both Rh negative and Southeast Asian gene of the Neanderthal Homo Erectus race people. Philippino are also possiblity because 300 years of Spanish rule and Southeast Aeta negritos genes Southeast Asia Neanderthal genes.

--Previous Message--
: Formula to form Jews, Gypsies, Germans and
: Amerindian to form there own pure Caucasian
: Caste.
: fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101
: and DR52a or Pure Rh ryr A- and B- Rh
: negative with also carry Laron Syndrome of B
: Rh negative with H3 haplogroup or subtype
: 271
: GHRH-R or insensitive Laron Syndrome protect
: against various cancers.
: DRB3*0101 and DR52a from Gorrilla or Homo
: Erectus Neanderthal
: B blood some protect against HIV
: B Rh negative have great protect agianst HIV
: mtDNA L-M11 trace roots to Darius the Great
: of Persia and Zoroaster Arianoi or pure
: Aryan.
: J1b trace to the Sumerians Ychromosome
: Jewish Exilarch or King all the Jewish and
: tribe of Judah and Benjamin.
: B Rh negative traces to tribe of Judah and
: Benjamin, Lilith, Samael, or Anahita or
: Ahura Mazda, Daniel or Zerubbabel and Virgin
: Mary.
: DRB1*0802 trace to Blackfeet Sioux and Mayan
: Amerindians.
: Rh ryr trace to Native American Rh negative
: people such as Aluet who B- Rh negative,
: Blackfeet Indian who are A- Rh ryr negative
: and Andes Indian who B- Rh ryr negatives.
: In Asia it is the Japanese Ural-Altaic (ighg
: 1G3 fbo1b3-b4-b5 rh-cde or Rh ryr with
: DRB3*0101 and DR52a or Pure Rh ryr A- or
: pure Caucasian race people.
:
: GTCGCTTC) with L-M11 is related to
: actatacttcttttgtgtgccttc (SEQ ID NO: 801 is
: related Yemenite Jews
: M271 is a new member of Subgroup H3. H3
: haplogroup came from pure Jews with both L
: and Q haplogroup with M271 which people with
: L-M11 haplgroup has the same Highly
: protective against AIDS progression.
:
: GTCGCTTC) with L-M11 is related to
: actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801
: is related Yemenite Jews and
: GTCGCTTC Major Frank Warren L haplogroup
: mtDNA sequence for Dwarfism of Sindh.
: Neoteny
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B genes is responsible for pupation
: (the stage in the development of an insect
: in which it lies in repose and from which it
: eventually emerges in the winged form) in
:
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B trigger male-limited precious
: puberty which people like me reach
: maturation at the age of years old. The gene
: is called GHRH-R which was Yemenite Jews
: carried to Ur Sumeria and to Persian
: Sassanian Royal with Exilarch
: Jewish(Yemenite Jews blood of Solomon and
: Sheba son Menelik. Nazbanu the daughther of
: Yazdegerd III from Pars carried L-M11 with
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B trigger male-limited precious
: puberty to Deval or Karachi in Sindh
: Province in now Pakistan is now called the
: Dwarfism of Sindh which is Male-Limited
: Precious Puberty without Luten related
: causes.
:
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B came from Mayan Indian which they
: got from the axolotl or Giant Tadpole which
: have Male-Limited Precious Puberty
: TGGTCATCCTTTGTCGCTTC (sense, position 759)
: Chironomus tentans 7108 7153 3959 C.tentans
: Sp38-40.A and Sp38-40.B genes.
:
: mtDNA 271 or 16271 in found in the Semang in
: Malaysia
:
: Virtually all of this reaearch has been done
: by non-LDS scientists, which is the best way
: to let the truth come out as it eventually
: will.
:
: H3 represents a smaller fraction of European
: genome than H1 but has a somewhat similar
: distribution with peak among Basques
: (13.9%), Galicians (8.3%) and Sardinians
: (8.5%). Its importance decreases towards the
: northeast of the continent though.[1]
: Studies have suggested haplogroup H3 is
: highly protective against AIDS
: progression.[12]
: M271 is a new member of Subgroup H3.
: mtDNA M271 originated Mainland Southeast
: Asia Negritos with the CDe or
: fa;b0b2b3b4b5tCDe found both in Malaysia
: Negritos and Amerindians.
: With this Formula you with pure Caucasian
: Neanderthal Rh negative blood with various
: protection natural protect with Cancers and
: HIV and pure Aryan features form the Jews.
: You have foutain of youth because you will
: have GHRH-R or insensitive Laron Syrdome
: which will normal child protection and but
: maturation will occur at the of 2 or 3 years
: old and young and old charatheristic will be
: totally preserved for life. You will age
: very slowly and live longer and with all the
: protect of against HIV and Cancers and other
: diseases. You will be a Super no African no
: Chimpanzee race of people.
:
:
:
:
:
: