--Previous Message--
: Formula to form Jews, Gypsies, Germans and
: Amerindian to form there own pure Caucasian
: Caste.
: fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101
: and DR52a or Pure Rh ryr A- and B- Rh
: negative with also carry Laron Syndrome of B
: Rh negative with H3 haplogroup or subtype
: 271
: GHRH-R or insensitive Laron Syndrome protect
: against various cancers.
: DRB3*0101 and DR52a from Gorrilla or Homo
: Erectus Neanderthal
: B blood some protect against HIV
: B Rh negative have great protect agianst HIV
: mtDNA L-M11 trace roots to Darius the Great
: of Persia and Zoroaster Arianoi or pure
: Aryan.
: J1b trace to the Sumerians Ychromosome
: Jewish Exilarch or King all the Jewish and
: tribe of Judah and Benjamin.
: B Rh negative traces to tribe of Judah and
: Benjamin, Lilith, Samael, or Anahita or
: Ahura Mazda, Daniel or Zerubbabel and Virgin
: Mary.
: DRB1*0802 trace to Blackfeet Sioux and Mayan
: Amerindians.
: Rh ryr trace to Native American Rh negative
: people such as Aluet who B- Rh negative,
: Blackfeet Indian who are A- Rh ryr negative
: and Andes Indian who B- Rh ryr negatives.
: In Asia it is the Japanese Ural-Altaic (ighg
: 1G3 fbo1b3-b4-b5 rh-cde or Rh ryr with
: DRB3*0101 and DR52a or Pure Rh ryr A- or
: pure Caucasian race people.
:
: GTCGCTTC) with L-M11 is related to
: actatacttcttttgtgtgccttc (SEQ ID NO: 801 is
: related Yemenite Jews
: M271 is a new member of Subgroup H3. H3
: haplogroup came from pure Jews with both L
: and Q haplogroup with M271 which people with
: L-M11 haplgroup has the same Highly
: protective against AIDS progression.
:
: GTCGCTTC) with L-M11 is related to
: actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801
: is related Yemenite Jews and
: GTCGCTTC Major Frank Warren L haplogroup
: mtDNA sequence for Dwarfism of Sindh.
: Neoteny
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B genes is responsible for pupation
: (the stage in the development of an insect
: in which it lies in repose and from which it
: eventually emerges in the winged form) in
:
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B trigger male-limited precious
: puberty which people like me reach
: maturation at the age of years old. The gene
: is called GHRH-R which was Yemenite Jews
: carried to Ur Sumeria and to Persian
: Sassanian Royal with Exilarch
: Jewish(Yemenite Jews blood of Solomon and
: Sheba son Menelik. Nazbanu the daughther of
: Yazdegerd III from Pars carried L-M11 with
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B trigger male-limited precious
: puberty to Deval or Karachi in Sindh
: Province in now Pakistan is now called the
: Dwarfism of Sindh which is Male-Limited
: Precious Puberty without Luten related
: causes.
:
: TGGTCATCCTTT(GTCGCTTC)(sense, position 759)
: Sp38-40.B came from Mayan Indian which they
: got from the axolotl or Giant Tadpole which
: have Male-Limited Precious Puberty
: TGGTCATCCTTTGTCGCTTC (sense, position 759)
: Chironomus tentans 7108 7153 3959 C.tentans
: Sp38-40.A and Sp38-40.B genes.
:
: mtDNA 271 or 16271 in found in the Semang in
: Malaysia
:
: Virtually all of this reaearch has been done
: by non-LDS scientists, which is the best way
: to let the truth come out as it eventually
: will.
:
: H3 represents a smaller fraction of European
: genome than H1 but has a somewhat similar
: distribution with peak among Basques
: (13.9%), Galicians (8.3%) and Sardinians
: (8.5%). Its importance decreases towards the
: northeast of the continent though.[1]
: Studies have suggested haplogroup H3 is
: highly protective against AIDS
: progression.[12]
: M271 is a new member of Subgroup H3.
: mtDNA M271 originated Mainland Southeast
: Asia Negritos with the CDe or
: fa;b0b2b3b4b5tCDe found both in Malaysia
: Negritos and Amerindians.
: With this Formula you with pure Caucasian
: Neanderthal Rh negative blood with various
: protection natural protect with Cancers and
: HIV and pure Aryan features form the Jews.
: You have foutain of youth because you will
: have GHRH-R or insensitive Laron Syrdome
: which will normal child protection and but
: maturation will occur at the of 2 or 3 years
: old and young and old charatheristic will be
: totally preserved for life. You will age
: very slowly and live longer and with all the
: protect of against HIV and Cancers and other
: diseases. You will be a Super no African no
: Chimpanzee race of people.
:
:
:
:
:
:
Message Thread
« Back to index